Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

tailieuhay_489
tailieuhay_489(15431 tài liệu)
(7 người theo dõi)
Lượt xem 2
1
Tải xuống
(Lịch sử tải xuống)
Số trang: 8 | Loại file: PDF
0

Gửi bình luận

Bình luận

Thông tin tài liệu

Ngày đăng: 16/03/2014, 18:20

Mô tả: Cloning and expression of a tomato cDNA encoding a methyljasmonate cleaving esteraseChristiane Stuhlfelder, Martin J. Mueller and Heribert WarzechaLehrstuhl fu¨r Pharmazeutische Biologie, Julius-von-Sachs-Institut fu¨r Biowissenschaften, Universita¨tWu¨rzburg, GermanyJasmonic acid and its methyl ester are ubiquitous plant s ig-nalling compounds nec essary f or the regulation of growthand development, as well as for the response of plants toenvironmental stress f actors. To date, it is not clear w hethermethyl jasmonate itself acts as a signal or if its conversion tojasmonic acid i s mandatory pri or t o the induction of a def-ense response. We have cloned a cDNA, e ncoding a m ethyljasmonate-cleaving enzyme, from tomato cell suspensioncultures. Sequence analysis revealed significant similarityto plant esterases and to (S)-hydroxynitrile lyases withan a/b-hydrolase fold structure. The coding sequence washeterologously expressed in Escherichia coli and purified ina c atalytically active form. Transcript levels, as well as en-zymatic a ctivity, were determined in different tomato tissues.High transcript levels and enzyme a ctivities w ere f ound inroots and flowers, while the m RNA level and activity w erelowinstemsandleaves.Moreover,whentestedinmethyljasmonate- and elicitor-treated cell s uspension cultures,transcript levels were found to decrease, i ndicating that thisparticular enzyme might b e a regulator of jasmonate sig-nalling.Keywords: a/b-hydrolase; cell suspension culture; Lyco-persicon e scule ntum; methyl jasmonate esterase; Solanaceae.Jasmonic acid (JA) is a ubiquitous plant compound, whichplays a crucial role in t he response to w ounding or pathogenattack, as w ell as i n developmental proce sses, such a s fruitripening, r oot growth, a nd fertility [ 1]. Most o f the en zymesinvolved in JA biosynthesis have been characterized at abiochemical and molecular level and the encoding geneshave been cloned. Biosynthesis takes place mainly inchloroplasts and peroxisomes, initiating after the releaseof the precursor linolen ic acid from membrane stores bylipases. The enzymes lipoxygenase, allene oxide synthase,and allene oxide cyclase form the b iosynthesic i ntermediate12-oxo-phytodienoic a cid (OPDA). Subsequent action ofOPDA reductase and three cycles of b-ox idation lead to theformation of JA [ 2,3]. Thereafter, JA may b e esterified to itsderivative methyl jasmonate (MeJA) [ 4], or c onjugated withan amino acid or glucose [5].For most of t he jasmonates it h as been shown that t heyare capable of mediating a response by regulating geneexpression [6,7]. Analysis of Arabidopsis thaliana mutantsimpaired in either JA biosynthe sis or signalling, gave adeeper insight i nto the function of single oxylipin s [8]. T hefad3–2fad7–2fad8 mutant, which forms almost no trienoicfatty acids [9], is male sterile and fertility could only berestored by application of linolenate or JA. Another mutant– opr3 – a rrests jasmonate biosynthesis at the OPDA leveland is incapable of metabolizing exogenously appliedOPDA to JA [10]. opr3 mutants d isplayed a normal defenseresponse towards a variety of pathogens, indicating thatOPDA alone is sufficient to initiate an effective defenseresponse. However, mutant plants were male sterile andfertility c ould be restored by th e exoge nous application ofJA. These experiments demonstrate that individual mem-bers of the jasmonate family are involved – at least inArabidopsis – in different signalling pathways.An Arabidopsis(jar1)mutantwithadefectinthejasmonate response has been described. The mutant isinsensitive to MeJA and does not show root growthinhibition or vegetative storage protein (VSP) ind uction inresponse to MeJA [11]. Recent analysis of the jar1 locusrevealed that its gene product modifies JA v ia adenylation,which is a pparently a p rerequisite for downstream signaling.The modification requires a free carboxyl group as theenzyme does not accept MeJA as a substrate [12]. T herefore,MeJA must be de methylated prior to becoming active.Thus, root growth inhibition and VSP expression aremediated by MeJA through JA, indicating that MeJA is notamediatoronitsowninthisparticularsystem.On the other hand, OPDA and JA can induce identicalgenes a s w ell as d istinct s ets o f t arget genes, suggesting thatindependent signalling pathways exist [13] and that thecombined action of different inducers might be necessary forthe full activation of responsive genes [14]. However, inCorrespondence to H. Warzecha , Lehrstuhl fu¨r PharmazeutischeBiologie, Julius-von-Sachs-Institut, Julius-von-Sachs-Platz 2,97082 Wu¨rzburg, Germany.Fax: + 4 9 9318886182, Tel.: + 49 9318886162,E-mail: warzecha@biozentrum.uni-wuerzburg.deAbbreviations: HNL, ( S)-hydroxynitrile lyase; JA, j asmonic acid;JMT, S-adenosyl-L-methionine jasmonic a cid carboxyl methyltrans-ferase; MeJA, methyl jasmonate; MJE, methyl jasmonate esterase;MeSA, methyl salicylate; OPD A , 12-oxo-phytodienoic acid; P I ,proteinase inhibitors; PNAE, polyneuridine aldehyde esterase;RACE, rapid amplification of c D NA ends; VSP, vege t ative storageprotein.Note: The sequence reported h erein was deposited under GenBankaccession number AY455313.Note: A website is available at http://132.187.108.6/(Received 2 8 March 20 04, revised 1 9 May 2004,accepted 25 May 2004)Eur. J. Biochem. 271, 2976–2983 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04227.xthe case of MeJA and JA, the biological activities of theexogenously administered compounds are apparently iden-tical, possibly because rapid interconversion takes placein vivo.Another quality of JA-mediated plant defense is thesystemic spread of defense responses after local induction.For instance, in tomato and potato plants the production ofproteinase inhibitors (PI) as an inducib le defense r esponseagainst feeding C olorado potato beetle is not limited to thesite of their attack, but also appears in distant leaves o f theplant [15]. The herbivore attack induces JA biosynthesislocally via systemin, an 18 amino acid s ignal p eptide.However, the induction of PI genes could be found also indistant parts of the plant, which requires a long distancesignalling component. Grafting experiments with tomatomutants deficient i n either J A biosynthesis or J A perceptionproved that a jasmonate, rather than s ystemin, is the signalwhich is translocated t hrough the plant [ 16]. Rootstocks ofthe spr-2 mutant, which are impaired in JA biosynthesis,were not capable of generating a transmissible signal thatcould induce PI expression in wild-type scions, whilewounded wild-type root stocks did induce PI e xpressionin spr-2 scions.A strong candidate for a transmissible jasmonate signal isthe JA-conjugate, MeJA. The volatile ester can diffusethrough membranes and c an be found in the headspaceabove w ounded leaves [17], suggesting that M eJA m ight bean interplant c ommunication signal [18]. M oreover, it hasbeen speculated that the physical role of MeJA is tomobilize JA [ 19]. The proof of this hypothesis might comefrom a more detailed understanding of how plants formMeJA from JA, and vice versa. A recent study identified anS-adenosyl-L-methionine:jasmonic acid carboxyl methyl-transferase (JMT) from Arabidopsis, w hich conver ts JA toMeJA [4]. Constitutive overexpression of JMT tripled theMeJA content of transgenic plants and also induced JA-responsive g enes. Therefore, t ransgenic plants with elevatedJMT levels s howed enhanced resistance against the necro-trophic fungus Botrytis cinerea, suggesting a prominent rolefor the enzyme in jasmonate-mediated defense.It is not yet clear whether MeJA functio ns as a paracrinesignal that is re leased from sites of pathogen attack toinduce defense genes at distant sites. Moreover, i t r emains tobe clarified whether MeJA is a mediator on its own thatelicits JA responses without prior hydrolysis to JA. How-ever, if M eJA is considered to be a s ignal, there must be away to regulate the signal by controlled formation and –perhaps more importantly – by its controlled inactivation.A candidate for performing the latter task is an est erase,previously characterized in tomato [20]. E nzyme activity hasbeen found to be constitutively present in cell cultures ofmany taxonomically distant plant species. In tomato cellcultures, only one MeJA-hydro lysing enzyme could beidentified by activity-guided protein purification. Thetomato esterase has been purified and characterized fromtomato cell suspension cultures. Owing to its MeJA-cleavingactivity, we named the enzyme methyl jasmonate esterase(MJE). Yet, it remains to be established w hether MJE has afunction in JA/MeJA signalling. As a first step to investigatethis, we cloned a cDNA from tomato encoding MJE.Analysis of transcript incidence showed that MJE isdifferently expressed in different organs as well as afterelicitation, indicating that this enzyme might be i nvolved i njasmonate signalling.Experimental proceduresPlant materialTomato plants (Lycopersicon e sculentum cv. M oneymaker)were grown in the greenhouse under con ditions of 16 h lightand 8 h darkness. The growth temperature range was16–22 °C with a relative humidity of 60–70%.Cell suspension cultures (L. esculentum )weregrownin1 L Erlenmeyer flasks in Linsmaier & Skoog media [21] for7 d ays under continuous light (600 lux) on orbital s hakers(100 r.p.m.) a t 24 ± 2 °C. Ce lls were harvested by suctionfiltration,shockfrozeninliquidnitrogen,andstoredat)80 °C until use.Nucleic acid isolation and blot analysesPlant material for the isolation of nucleic acid was either4-day-old cell s uspension c ulture or 8-week-old plants. T otalRNA from suspension cultures w as isolated either accord-ing to the protocol described previously [22], or with theTRIzol reagent ( Invitrogen), and used for RT-PCR orNorthern blots, respectively. Isolation of RNA from p lantmaterial was c arried out using the RNeasy Plant M ini Kit(Qiagen). For DNA purification the protocol describedpreviously [23] was employed.Standard protocols were used for the transfer of RNAand DNA after electrophoretic sep aration [24]. Hybridiza-tion of RNA or DNA transferred to n ylon membranes wasperformed using a nonradioactive digoxigenin-probe label-ling system (Roche).RT-PCR and cloning of partial- and full-length cDNATwo degenerated primers were designed according topreviously determined peptides. Sequences were YTTRTCRCANACNACRTANACNCKRTGNACNSWNCCRTAfor MJErev4 and GAYATGGCNGCNWSNG GNATHAAYCC for MJEfor3.1. With total RNA from cell suspen-sion cultures and primer MJErev4 for first-strand synthesis,cDNA was produced using the RT-PCR s ystem fr om Qiagen .RT-PCR conditions were 30 min at 5 0 °C, 15 min at 9 5 °C;five cycles of 30 s at 94 °C, 1 m in at 40 °Cand1minat72 °C, followed by 30 cycles of 30 s a t 94 °C, 1 min at 45 °Cand 1 min at 72 °C. Gel electrophoresis, DNA elution a ndmodification was carried out according to standard protocols[24]. A fter c loning o f th e P CR pr oduct into the v ector pG EM-T ( Promega) and s equencing (automated s equencer LI-COR4200), two homologous primers were designed for the rapidamplification of cDNA ends (RACE) (RACEfor: GTGACAGCTTTCATGCCTGG; and RACErev: ATCCTGTCCGTTGTTGTAAAC). 5¢-and3¢-RACE w as performedusing the SMART II system (BD Bioscience). Full-lengthcDNA for expression was cloned by another RT-PCR withprimers f ullMJEforMQ (GCA TGCAGGGTGATAAAAATCACTTTGTA) and fullMJErev (AAGGATCCATAATATTTTTGCGAA ATC), adding rest rictio n sites for SphIand BamHI, r espectively. Th e PCR pr oduct w as cloned i ntovector pDRIVE (Qiagen), sequenced and subcloned intoÓ FEBS 2004 Methyl jasmonate esterase from tomato (Eur. J. Biochem. 271) 2977expression vector pQE70 (Qiagen) via SphIandBglIIrestriction s ites.Overexpression and purificationEscherichia c oli M15 cells harbouring the MJE e xpressionplasmid w ere cultured a t 20 °C on a rotary shaker(200 r.p.m.). Twenty-four hours after induction with1mMisopropyl thio-b-D-galactoside, cells of a 5 L suspen-sion were harvested and lysed by sonication. The crudeextract was cleared by centrifugation (10 000 g) and separ-ated on Q-Sepharose fast-flow 26/20, gel-filtration onSephacryl S-100 HR 26/60, and MonoQ HR 5/5 (allAmersham Biosciences), according t o a procedure describedpreviously [20]. For metal affinity chromatography, Talonresin ( BD Bioscience) was utilized. A nalysis of proteins wasperformed with SDS/PAGE (12.5%) under denaturatingconditions, a nd gels were silver stained as d escribedpreviously [25]. For Western blot analysis, proteins wereblotted onto nitrocellulose filters and detected withanti-6·His primary antibody, alkaline phosphatase-labeledsecondary antibody and chemoluminescent substrate(CDP-Star; Roche) .MJE activity was monitored according to a previouslypublished protocol [20].ResultsIsolation of MJE cDNAWe previously described an MJE, which is the only or atleast the predominant protein with MJE a ctivity i dentified intomato cell c ulture s. On the basis of the p artia l amino a cidsequences obtained from the purified MJE [20], twodegenerate primers were developed. T his method has beenproven successful in several r eports [26,27] and s hould leadto the identification of the encoding gene rather thanorthologous genes. Owing to the similarity of the peptidefragments with sequences of known proteins, the sequencePF18b (DMAASGINPK) was utilized to design a senseprimer, and sequence PF23 (RVYVVCDKD) w as used forthe generation o f an antisense prime r. Using tomato cDNAas a template, a 498 bp fragment was amplified by PCR.Sequencing revealed a DNA s tretch that e ncodes a peptidewith sequence similarity to a/b-hydrolase fold proteins (datanot shown), some of w hich have been p reviously aligned tothe internal fragments of purified MJE [20]. To obtain thefull-length cDNA by RACE, t wo seq u ence-specific prime rswere synthesized, generating overlapping fragments after5¢-and3¢-RACE, respectively. Sequencing and annealing ofthe 5¢ and the 3¢ sequence revealed an ORF of 789 bp,encoding a 262 amino acid protein (Fig. 1). All four p eptidesfrom the purified tomato protein could be identified in thededuced amino acid sequence, which substantiates that thecloned cDNA encodes the purified protein. The calculatedmolecular m ass o f the encoded protein is 29 524.93 Da andthe pI ¼ 5.52. The calculated mass o f the encoded proteincorresponds well with the m olecular mass of  28 000determined by SDS/PAGE for the purified plant protein.Comparison of the N-termini showed that the proteinoriginally purified from tomato lac ked two amino acids:Met and Glu. It could not be concluded if this was a result ofdegradation of the protein during the purification process orwhether t he protein was modified in vivo .Nopeptidesignalfor subcellular targeting could b e i dentified.Sequence alignmentSequence analysis a nd alignment with known proteins f romGenBank showed a high similarity of MJE to ethylene-induced esterase from Citrus sinensis (47% identity, 65%positivity) [28], the tobacco salicylic ac id binding protein 2(SABP2) (47% identity, 65% positivity) [29], the polyneu-ridine aldehyde esterase (PNAE) from Rauvolfia serp entina(44% identity, 65% positivity) [27], and s everal lyasesinvolved in the biosynthesis of cyanogenic compounds indifferent plant species [36% identity to (S)-hydroxynitrilelyase (HNL) from Hevea brasiliensis [30], 33% to (S)-Fig. 1. Tomato methyl jasmonate esterase cDNA and deduced proteinsequence. Pe ptides determined by seq ue ncing of the p urified protein areboxed and the names of the peptides are indicated in italic lettersabove. Nucleic acids o f the ORF are shown in ca pital letters, while 5¢and 3¢ untranslated regions are in lowercaseletters.Theputativeamino acid r esidues of t he catalytical t riad of a/b-hydrolase fold pro-teins are marked with an asterisk.2978 C. Stuhlfelder et al.(Eur. J. Biochem. 271) Ó FEBS 2004acetone-cyanohydrin lyase from Manihot esculentum][31].In addition, several putative proteins from the Arabidopsisgenome exhibited high sequence similarity to MJE. Forsequence alignment and analysis, only known or at leastpartially characterized proteins were included (Fig. 2). Asall the aligned proteins belong to the extremely divergentfamily of a/b-hydrolase fold proteins, i t c ould b e assumedthat MJE is a member of this protein family. As furthersupport of this assumption, MJE shows the highly con-served amino acid residues forming the catalytic triad [32] –nucleophile, acid, and a his tidine – represented b y s erine atposition 83, aspartic acid at position 2 11, and histidine atposition 240 (Fig. 2). Moreover, it has been shown thatMJE could be irreversibly in hibited by phenylmethanesulfo-nyl fluoride [20], a specific inhibitor o f s erine hydrolases [33].Bacterial expression and purification of tomato MJETo obtain unequivocal evidence of the identity of the clonedsequence, MJE cDNA was subcloned i nto a bacterial vectorfor h eterologous expression. As amplification of the codingsequence with a forward primer homologous to the 5¢-endfailed, the primer s equence had to be modified f or enhancedbinding and amplification. Primer design was carried outusing t he Vector NTI Software (Informax). Thereby, amodified N-terminus of the encoded protein was created inwhich Glu and Lys in positions 2 and 3, respectively, werereplaced with a single Gln.At the C -terminus a 6 ·His extension was added tosimplify subsequent purification of the protein. Crudeextracts of E. coli M15 cells harbouring the pQE-MJEplasmid showed MJE-esterase activity (1.64 pkatÆmg)1)after isopropyl thio-b-D-galactoside induction, while wild-type M15 cells did not show any MJE activity. This v aluewas comparable with the activity found in crude extractsfrom tomato cell suspension culture in previous experiments(1.77 pkatÆmg)1) [20], but was much less t han expected foran enzyme from heterologous bacterial expression of thecDNA. For visualization of proteins, bacterial extracts weresubjected to SDS/PAGE. In a comparis on of MJE-produ-cing E. coli with wild-type cells, no p rominent protein w iththe approximate size of MJE (29 kDa) could be detectedFig. 2. Multiple sequence alignment. Alignment of methyl jasmonate esterase (MJE) with a/b-hydrolase fold proteins fr om different plant species.EIE, ethylene-induced este rase from Citr us sinensis (GenBank accession number AAK58599); SABP2, salicylic acid-binding protein from Nic-otiana tabac um (AY485932); PNAE, polyneuridine aldehyde esterase from Ra uv olfia serpentina (AAF22288); Pir7b, d efense-related ri ce ge ne fromOryza sativa (CAA84024); H NL, (S)-hydroxynitrile lyase f rom Hevea brasiliensis (P52704).Ó FEBS 2004 Methyl jasmonate esterase from tomato (Eur. J. Biochem. 271) 2979after Coomassie Blue staining (data not shown). Thisobservation suggests that M JE is not abundantly producedor that it is not stable in E. coli. Because of the lowabundance in E. coli, a four-step purification protocol wasemployed to purify the enzyme (Table 1). Catalyticallyactive enzyme was obtained after anion exchange onQ-Sepharose, gel filtration with Sephacryl S-100, furtheranion-exchange chromatography on MonoQ, and finallyseparation on immobilized metal affinity chromatography(Talon resin). Starting from a 5 L bacterial s uspensionculture, MJE(His)6could be enriched 203-fold, resulting in52 lg of protein. Figure 3 A s hows the silver-s tained poly-acrylamide gel from the purified fraction. Although someimpurities are visible, we assume that solely the MJE isresponsible for MeJA-cleaving activity, as wild-type E. coliis not capable of c leaving M eJA. A n a ntibody s pecific f orhexa-histidine epitopes was used in an immunoblot experi-ment to con firm the p resence and the size of the recombin-ant protein. As shown in Fig. 3 B, extracts from E. coliharbouring pQE-MJE showed a b and o f  29 kDa repre-senting MJE(His)6, while wild-type bacteria did not.Southern blot analysisFor Southern blot analysis, genomic DNA from cellsuspension cultures or greenhouse-grown tomato plants(L. esculentum cv Moneymaker) was digested with BamHI ,EcoRI, or HindIII restriction enzymes and probed with afull-length cDN A of MJE at high stringency. It should benoted that the MJE-coding sequence has a recognition sitefor EcoRI at position 204 and therefore should show at leasttwo b ands in a Southern blot a nalysis. In addition to this ,the probe hybridized with multiple bands (Fig. 4).In the case of HNL from Cassava – which shows highsimilarity to MJE – several gene copies were reported [ 34]. Itcould not be concluded from our data whether tomatocontains several homologous genes, if some signals are aresult of probe hybridization with pseudogenes, or ifmultiple bands occur o wing to the presence of recognitionsites for the utilized restriction enzymes within introns (asassumed f or the HNL from Hevea) [30]. However, duringthe purification of MJE there was n o evidence for theexpression of isoenzymes, although, if present, they mighthave different catalytic properties.Northern blot analysis and induction of MJE expressionin cell culturesNorthern blot analysis was u sed to determine MJEtranscript levels in different plant organs. Therefore, totalRNA from roots, leaves, stems, and flowers was probedwith full-length MJE cDNA. Transcripts of  1kbwerepresent i n a ll plant tissues and significant v ariations in theiramounts could be d etected (Fig. 5A). High levels of MJEmRNA could be found in roots a nd flowers, while low-to-moderate amounts w ere present in the leaves and stems oftomato plants. The RNA levels correspond well with theMJE activity found in different plant organs, showing thathigh enzymatic a ctivity c orrelates w ith a high transcript level(Fig. 5 B).Table 1. Purification of recombinant methyl jasmonate e sterase.Purification stepTotal protein(mg)Total activity(pkat)Specific activity(pkat)Purification(fold)Recovery(%)Crude extract 2044 3352 1.64 1 100Q-Sepharose Fast Flow 712 1317 1.85 1.13 27.7Sephacryl HR 26/60 67.5 652.7 9.67 5.89 19.4Mono Q HR 5/5 1.9 100.6 54.39 33.16 3.0Talon resin 0.052 24.1 464.3 283.11 0.8Fig. 3. SDS/PAGE and Western blot a nalysisof me thyl jasmonate esterase (MJE) purifiedfrom rec ombinant bacteria. (A) Silver-stainedproteins after separation b y SDS/PAGE(12.5% gel). M, marker proteins (sizes areindicated on t he left); lane 1, purified f ractionafter t he last pu rification step. MJE is indica-tedbyanarrow.(B)Westernblotofcrudebacterial extracts after transfer to n itrocellu-lose. An antibody specific for 6·His modifiedproteins was used. L ane M, pr otein standard;lane 1, Escherichia coli harbouring expre ssionplasmid p QE70-MJE; lane 2, E. coli withoutthe expression plasmid. MJE is indicated withthe arrow.2980 C. Stuhlfelder et al.(Eur. J. Biochem. 271) Ó FEBS 2004In order to evaluate whether transcript levels could beregulated b y external stimuli, cell s uspension c ultures weretreated with MeJA, m ethyl salicylate (MeSA), or chitosan,and mRNA levels were determined in a time-dependentmanner. While basal levels of m RNA w ere h igh in untreatedcultures, t he levels decreased 1 h after MeJA treatment andreturned to basal levels  8 h postinduction (Fig. 5C). Asimilar time c ourse could b e observed a fter treatment w iththe elicitor chitosan, although with a slightly delayedresponse. No changes in mRNA levels were observed aftertreatment with MeSA.DiscussionSequence alignment of the MJE revealed high similarity toa/b-hydrolase fold proteins of different origin a nd withdiverse properties. Notably, all plant proteins of knownfunction with high sequence s imilarity to MJE appear to beinvolved in the defense response and/or secondary metabo-lism. Among the related proteins is the ethylene-inducedesterase from C. sinensis [28], a recently discovered SABP2from tobacco [29], the Pir7b protein from Oryza sativa,hydroxynitrile lyases of different origins and the PNAEfrom the medicinal plant R. serpentina. Nevertheless, thesubstrate acceptance and enzymatic activity of thoseenzymes, if known, is highly diverse. With the increasingnumber o f s pecified plant enzymes of this g roup of the a/b-hydrolase f amily, i t might be assumed t hat they have arisenfrom a common ancestral gene and the descendantspartially occupied species-specific niches in secondarymetabolism. Similar scenarios have been described for plantO-methyl transferases [35,36] or dioxygenases [37]. It shouldFig. 4. Southern blot analysis of total genomic DNA from tomatoplants. Fifty micrograms of DNA was digested overnight withrestriction enzymes and separated on a 1% agarose gel. M, sizestandard; lane 1, Bam HI-digested DNA; lane 2, EcoRI digest; l ane 3,HindIII dig e st.Fig. 5. Levels of methyl jasmonate esterase (MJE) t ranscripts in dif-ferent tissues and after induction. (A)NorthernblotoftotalRNAfromdifferent tissues hybridized with the full-length cDNA probe. RNAwas isolated from roots, leafs, stems and flowers. The lower panelshows 17S rRNA as a loading control (after methylene-blue staining);the results shown were consistent in three different experiments.(B) Specific activity of MJE in different plant organs. (C) Time courseof MJE t ranscript a b undance after treatment with methyl jasmonate(MeJA), methyl salicylate (MeSA), an d chitosan. Lo ading contr olsshow the ethidium b ro mide-stained gel p rior to transfer.Ó FEBS 2004 Methyl jasmonate esterase from tomato (Eur. J. Biochem. 271) 2981be noted that in the Arabidopsis genome at least 20 geneswith homologies to HNL and PNAE could b e found. It isunlikely that they have similar properties to the a/b-hydrolase fold proteins m entioned above, as they occur onlyin distinct plan t families o r even s pecies and t heir substratesare not present in Arabidopsis. O n the other hand, MJEactivity could be found in several plant systems. From the 1 8plant cell suspension cultures of taxonomically distantspecies tested to date, virtually all exhibited MJE activity[20]. O ne might s peculate that the M JEs of different speciesare encoded by orthologous genes.Whenever analysed, plant cells and tissues contain JAand its methyl ester, MeJA, side by side. In most reports,authors have made little effort to distinguish between thebiological activity of the two compounds and usually onlyJA content is measured. If values of bo th JA and MeJA arepublished, the ratios depend on the plant species and thetissue a nalysed a nd vary from 3 : 2 (JA/MeJA) i n Arabid-opsis leaves [4] to a bout 10 : 1 in tomato flowers [38]. Fortomato cell suspension cultures, a JA/MeJA ratio of almost1 : 1 was found [39]. To d ate there is no way ofdistinguishing between the function of the two compound son a physiological basis as they can be rapidly convertedfrom one into the other. For the Arabidopsis jar1 mutant, i thas been shown that the role of JAR1 is to modify JA viaadenylation of the carboxyl group [12]. As MeJA is notaccepted as a substrate in this putative essential stepinvolved in JA signalling, it is probable t hat MeJA has tobe hydrolyzed by MJE in order to become metabolicallyactivated. In this case, MeJA might represent a pool of inertJA conjugates or plays a role as signalling molecule betweenindividual cells [19]. The inverse activity of JMT and MJEsuggests that both enzymes should be spatially separated.MJE transcript levels were analyzed by Northern hybrid-ization a nd revealed a high, constitutive expression in rootsand flowers and low RNA levels in leaves a nd stems,suggesting that enzyme activity could b e found in all tissues.These data were supported by activity assays of MJE indifferent plant organs, which signify that high enzymaticactivity is contingent on high transcript levels.Interestingly, undifferentiated tomato cell suspensioncultures accumulate both JA and MeJA at almost e quallevels while displaying high MJE activity, suggesting thatindividual cells may contain both JMT and MJE activity.However, it is unlikely that a cell forms MeJA under theexpenditure of energy and degrades it immediately. Intra-cellular s eparation of MeJA synthesis and hydrolysis wouldbe one way to avoid a treadmill situation, yet analysis oftomato MJE and Arabidopsis JMT reveals no evidence forsubcellular targeting of the enzymes and, thus, bothenzymes should reside in the cytosol. Alternatively, sub-strates may be presented for the enzymes in a highlyregulated manner.To this end, it would be an a ppealing s cenario that a cellcould distinguish between endogenously formed and exo-genous MeJA. Endogenously formed MeJA might beexported and not hydrolysed, while MeJA coming fromoutside the cell m ay be recognized as an alar m signal that –after hydrolysis to JA – functions as intracellular defensesignal. In fact, a similar situation occurs in mammals.Stimulated neutrophils may synthesize (within minutes)leukotrienes, which are exported into the extracellularenvironment where they act as autocrine and paracrinesignals. Ho wever, neu trophils are also capable of taking upleukotrienes for intracellular catabolism, thereby locallyrestricting and terminating the signal.Transcript levels were also monitored after stimulationof tomato cell cultures with exogenous MeJA or theelicitor chitosan, which induces intracellular synthesis ofjasmonates in tomato [40]. Constitutively high MJEaccumulation transiently declined within 2 and 3 h afterthe treatments, respectively. Decreasing transcript levelsmay not immediately affect enzyme activity and thusexogenous MeJA can still be hydrolysed to JA for sometime. H owever, downregulation of MJE by exogenou sMeJA may limit MeJA hydrolysis and J A signalling whencells are exposed to elicitors/jasmonates over longer time-periods. Interestingly, basal transcript levels of JMT inArabidopsis leaves are low, and stimulation by exogenousMeJA transiently increases JMT formation. Overexpres-sion of JMT cDNA has been shown to increase thesynthesis o f MeJA [4], which, in turn, may leave producercells and function as an intercellular signal. As MJEactivity has been detected in all plant tissues examined sofar, MJE-harbouring cells may trap the volatile and highlydiffusible MeJA entering cells from the outside byhydrolysis to JA anions inside the cells. Inc reasing JAlevels might t hen elicit specific responses. In the future,generation and careful analysis of transgenic plants thateither constantly accumulate MJE or that are devoid ofMJE will help to solve the question of whether or notMeJA is a paracrine or even a long-distance signal.AcknowledgementsThis work was supported by t he Sonderforschungsbereich (SFB) 567.The a u thors thank Susanne Michel for performin g DNA sequen cing.References1. Creelman, R.A. & Mullet, J.E. (1997) Biosynthesis a nd action ofjasmonates in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48,355–381.2. Mueller, M. (1997) Enzymes i nvolved in j asmonic acid b iosyn-thesis. Phys iol. Plant. 10 0, 653–663.3. Schaller, F. (2001) Enzymes of the biosynthesis of octadecanoid-derived s ignalling molecules. J. Exp. Bot. 52 , 11–23.4. Seo, H .S., S o ng, J .T. , C heon g, J.J., L ee , Y .H., Lee, Y.W., H wang,I., L ee, J.S. & Choi, Y .D. (2001) Jasmonic ac id carboxyl methyl-transferase: a key enzyme for jasmonate-regulated plant r esponses.Proc.NatlAcad.Sci.USA98, 4 788–4793.5. Sembdner, G. & Parthier, B. (1993) The biochemistry and thephysiological and molecular actions of jasmonates. Annu. Rev.Plant Physiol. Plant Mol. Biol. 44, 569–568.6. Wasternack, C . & Parthier , B. ( 1997) Jasmonate-signalled p lantgene expression. Tre nds Pl ant Sci. 2, 302–307.7. Kramell, R., Miersch, O., Atzorn, R., Parthier, B. & Wasternack,C. (2000) Octadecanoid-derived alteration of gene expression andthe Ôoxylipin signatureÕ in stressed barley leaves. Implications fordifferent signali ng pathways. Plant Physiol. 123 , 177–188.8. Berger, S. (2002) Jasmonate-related mutants of Arabidopsis astools f or studying s tress signaling. Planta 214, 497 –504.9. McConn,M.&Browse,J.(1996)Thecriticalrequirementforlinolenic acid is pollen development, not photosynthesis, in anArabidopsis mutant. Pl ant Cell 8, 403 –416.2982 C. Stuhlfelder et al.(Eur. J. Biochem. 271) Ó FEBS 200410. Stintzi, A., Weber, H., Reymond, P., Browse, J. & Farmer,E.E. (2001) Plant defense in the absence of jasmonic acid: therole of cyclopentenones. Proc. Natl Acad. Sci. USA 98, 12837–12842.11. Staswick, P.E., Su, W. & Howell, S. H. (1992) Me thyl jas monateinhibition of root growth and induction of a leaf protein aredecreased i n an Arabidopsis thaliana mutant. Proc. Natl A cad. Sc i.USA 89, 6837–6840.12. Staswick, P.E., Tiryaki, I. & Rowe, M.L. (2002) Jasmonateresponse locus J AR1 a nd several related Arabidopsis genes enc odeenzymes of the firefly luciferase superfamily that show activity onjasmonic, salicylic, and indole-3-acetic acids in an a ssay for ade-nylation. Plant Cell 14, 1405–1415.13. Reymond,P.,Weber,H.,Damond,M.&Farmer,E.E.(2000)Differential gene exp ression in respon se to mechanical woundingand i nsect f eeding in Arabidopsis. Plant Cell 12, 707–720.14. Howe, G.A. (2001) Cyclopentenone signals for plant defense:remodeling the jasmonic acid response. Proc.NatlAcad.Sci.USA98, 12317–12319.15. Stratmann, J.W. (2003) Long distance run in the wound response– j asmonic acid is p ulling ahead. Trends Plant Sc i. 8, 247 –250.16. Li, L., Li, C., Lee, G.I. & Howe, G.A. (2002) Distinct roles forjasmonate synthesis a nd ac tion in th e s ystemic w ound res ponse oftomato. Proc. Natl Acad. Sci. USA 99, 6416–6421.17. Meyer, R., Rautenbach, G.F. & D ubery, I.A. (2003) Identificationand q uantification of methyl jasm onate in leaf v olatiles o f Arabi-dopsis thaliana usin g s olid-phase m i croextraction i n combinationwith gas chromatography and mass spectrometry. Phytochem.Anal. 14, 155–159.18. Farmer, E.E. & Ryan, C.A. (1990) Interplant communication:airborne methyl jasmonate induces synthesis of proteinase in-hibitors in plant l eaves. Proc . Natl Acad. Sci. USA 87, 7713–7716.19. Weber, H . (2002) Fatty acid-derived signals in plants. Trends PlantSci. 7, 217–224.20. Stuhlfelder, C., Lottspeich, F. & Mueller, M .J. (2002) Purificationand partial amino acid sequences of an esterase from tomato.Phytochemistry 60 , 233–240.21. Linsmaier, E.M. & Skoog, F. (1965) Organic growth factorrequirements of tobacco tissue cultures. Physiol. Plant. 18, 100–127.22. Ausubel, F.M., Brent, R ., King ston, R.E., Moore, D.D., S mith,J.A.,Seidman,J.G.&Struhl,K.E.(1994)Current Protocols inMolecul ar Biology . Greene a nd. Wiley, New York.23. Rogers, S.O. & B endich, A.J. ( 1985) Extraction o f D NA frommilligram amounts of fr esh, herbarium a nd mummified plant tis-sues. Plant Mol. Biol. 5, 69–76.24. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) MolecularCloning – a Laboratory Manual, 2nd ed n. Co ld Spring H arborLaboratory Press, Cold Spring Harbor, New Y o rk.25. Blum, H., Beier, H. & Gross, H.J. (1987) Improved silver stainingof prote ins, RNA, DNA in polyacrylamide gels. Electrophoresis 8,93–99.26. Warzecha, H., Gerasimenko, I., Kutchan, T.M. & Stockigt, J.(2000) Molecular cloning and functional bacte rial expression of aplant glucosidase specifically involved in alkaloid biosynthesis.Phytochemistry 54 , 657–666.27. Dogru,E.,Warzecha,H.,Seibel,F.,Haebel,S.,Lottspeich,F.&Stockigt, J. (2000) The gene encoding polyneuridine aldehydeesterase of monoterpenoid ind ole a lkaloid biosynthesis in p lan ts i san orth olog of the alpha/beta h ydrolase super family [In ProcessCitation]. Eur. J. Biochem. 267, 1397–1406.28. Zhong, G.Y., Goren, R., Riov, J., Sisler, E.C. & Holland, D.(2001) Characterization of an ethylene-induced este rase gene iso-lated from Citrus sinensis by competitive hybridization. Physiol.Plant. 113, 2 67–274.29. Kumar, D. & Klessig, D.F. (2003) High-affinity salicylic acid-binding protein 2 i s req uired for p lan t innate imm unit y and hassalicylic acid-stimulated lipase activity. Proc. Natl Acad. Sci. USA100, 1 6101–16106.30. Hasslacher, M., Schall, M., Hayn, M., Griengl, H., Kohlwein,S.D. & S chwab, H. (1996) Molecular cloning of the full-lengthcDNA o f (S)-hydroxynitrile lyase f rom Hevea brasi lien sis . Func-tional expre ssion in Escherichia c oli and Saccharomyces cerevisiae,and identification of an active site residue. J. Biol. Chem. 271,5884–5891.31. Hughes, J., Carv alho, F.J. & Hughes, M .A. (1994) Purification,characterization, and cloning of alpha-hydroxynitrile lyase f romcassava (Manihot esculenta Crantz). Arch. Biochem. Biophys. 311,496–502.32. Heikinheimo, P., Goldman, A., Jeffries, C. & Ollis, D.L. (1999) Ofbarn owls and bankers: a lush variety of alpha/beta hydrolases.Structure F old Des. 7, R141–R146.33. Gold, A.M. (1965) Sulfonyl fluor ides as inhibitors of esterases.Identification of serine as the site of sulfonation in phenyl-methanesulfonyl alpha-chymotryp sin. Biochemistry 4, 897–901.34. Hughes, J ., Keresztessy, Z ., Brown, K., Su handono , S . & Hughes,M.A. (1998) Genomic organization and structure of alpha-hydroxynitrile lyase in cassava (Manihot e sculenta Crantz). Arch.Biochem. Biop hys. 356, 107–116.35. Ibrahim, R.K., Bruneau, A. & Bantignies, B. (1998) Plant O-methyltransferases: m olecular analysis, common signature andclassification. Plant Mol. Biol. 36, 1–10.36. Pichersky, E. & Gang, D.R. (2000) Ge netics and b iochemistry o fsecondary metabolites in plants: an evolutionary perspective.Trends Pla nt Sci. 5, 439–445.37. Kliebenstein, D.J., Lambrix, V.M., Reichelt, M., Gershen zon, J. &Mitchell-Olds, T. (2001) Gene dupl ication in the diversification ofsecondary metabolism. Tandem 2-oxoglutarate-dependent dioxy-genases control glucosinolate biosynthesis in arabidopsis. PlantCell 13 , 681–693.38. Hause, B., Stenzel, I., Miersch, O., Maucher, H., Kramell, R.,Ziegler, J. & Wasternack, C. (2000) Tissue-specific o xylipin sig-nature of tomato flowers: allen e oxide cyclase is highly expressedin dist inct flower o rgans a nd vascular b undles. Pla nt J . 24, 113–126.39. Gundlach, H., Mull er, M .J., Ku tcha n, T.M. & Z enk, M.H. (1992)Jasmonic acid is a signal transducer i n elicitor-induced plant cellcultures. Proc.NatlAcad.Sci.USA89, 2 389–2393.40. Doares, S.H., Syrovets, T., Weiler, E.W. & Ryan, C.A. (19 95)Oligogalacturonides a nd chitosan activate plant defensive genesthrough the o ctadecanoid pathway. Proc. Natl Acad. Sc i. USA 92,4095–4098.Ó FEBS 2004 Methyl jasmonate esterase from tomato (Eur. J. Biochem. 271) 2983 . Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase Christiane Stuhlfelder, Martin J. Mueller and Heribert WarzechaLehrstuhl. was cloned by another RT-PCR withprimers f ullMJEforMQ (GCA TGCAGGGTGATAAAAATCACTTTGTA) and fullMJErev (AAGGATCCATAATATTTTTGCGAA ATC), adding rest rictio

— Xem thêm —

Xem thêm: Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf, Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf, Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

Lên đầu trang

Tài liệu liên quan

Từ khóa liên quan

Đăng ký

Generate time = 0.110431909561 s. Memory usage = 14 MB